This skin is best viewed in Google Chrome, Mozilla Firefox or Safari.
It does not look that good in Internet Explorer, so please switch to some other browsers.
|
|
Thursday, October 29, 2009
5L gelato and 5gigabyte of Virus and Diseases
Lecture notes lying around my desk, my bed and floor. Reference books lying in my bag and floor.
When will I have a chance to get those out of my sights?
3 more days towards my first paper and I am bloody dead tired. Even before the "war" started, I am already defeated by my tired-ness.
Within these 3 days, I must get RNA/DNA/Envelope/Naked/Genome Size/Diameter/Diseases into my lacking-of-space brain!
Here's the FIVE LITRE of PASSIONFRUIT GELATO that I had it in my entire life. That's the best thing happened to me during exam period. =/
Last Breath of Cammie
|
|
Saturday, October 24, 2009
Time is ticking fast
My eyebags are getting bigger as each day passed. Each time the clock start ticking, I know I am running out of time. I have only left 2 weeks to prove my capability in two 2 hours exam and one 3 hours exam. Sometimes I really wish that I can find a time to breathe regularly.
Like I said, I should run this race blindly by giving all my best. I know I have not given my very best yet. Yah, I know I have not!
- Sleepy cammy -
|
|
Thursday, October 22, 2009
Feel blissed
Awwww.......thank you K. I totally appreciate you for going an extra mile to send me my lead.....
Yes I am fussy and picky. I only use PILOT 3B. AND if IT ever going to be out-of-stock, I am going to find you no matter what.
Another week, my exam will start. I am stressed. I am tired. I still have tons of study materials to learn and understand. Uni is not about mugging, seriously, it's more towards learning and understanding. The more you read, the more you understand and the more you learn. However, time is always the limiting factor. Whilst, stress and tired-ness are always the intrinsic factors resulting in you being drifted away.
- Fatigue cammie -
|
|
Wednesday, October 21, 2009
Weary Cammy
I am seriously exhausted. I know the finishing line is up there waiting for me and thus I am requirde to use my last breath (though exhausted) to finish this.
However, the question is, will I be able to do so?
True in a way that the last lap of race is always the most tiring part. Scary in a way that you are actually lacking behind. Thus, the only way I can finish up this race is to finish it blindly and subconciously.
- Weary Cammy -
|
|
Sunday, October 18, 2009
ATCG cammie
AGTAGTAGTAGATGATGATAGATGACGCTAGCATGCCCCCCCGTAGCTAGCATCGATG CGATCGATGCTAGCATCGATGCATCGATCGATGATCGTCTCGCTGCCTCGCGCGCTAG CGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGACGT CGACGATCGATCGATCGATCGATCGTAGCATCGATCGATCGATCGAGCATCGATCGAT CGACGATGCATCGATCGATCGATCGATCGATCGATCGATCGATCGACTAGCATCGATA
Why are these familiar to me? Oh! It just so happened that I have been looking at these for the whole damn NINE effing HOURS!!! After this, it would be medical virology which will be -virales, -viridae, -virinae, -virus.TIREd CAMMie
|
|
Saturday, October 17, 2009
cammie is lacking behind
If you know me well enough, you will know that I always have a high expectation for everything. As for today, I realized I am lacking behind; I am not outstanding; I am just a nobody. I really wouldnt mind being low profile with outstanding capabilities.
However, when you have reached your goals and became outstanding, you will eventually lose something especially your love ones and yourself. So it is like a stake of choosing what you want because at the end of the day you will lose something. That something you lose is determined by the choice you made.
-exhausted cammie-
|
|
Wednesday, October 14, 2009
Tired cammie
I have not been myself lately. Everything seems so disorganized and I am definitely running away from the tasks especially the data analysis of DNA. I will always skive if I find any chance to do so.I am feeling weary now. My body is giving away any time, any day.
|
|
Tuesday, October 13, 2009
cammie is lost once again
I know I shouldnt be blogging right now. I know I have million of tasks that are left to be done. I know I should be studying hard and mugging all the journal papers and those exterior materials that I have in my lappy. However, I am not doing so. I feel like life is meaningless.
My only motivation is Duke but what if Duke does not want to accept me? What if after working so hard, I realize this is not really want I want. There's no turning back, the more you study, the more you have to be specialized in some areas. When you are specialized in certain area, you realize this is not what you want. By then, it's too late to turn back.
I am lost.
|
|
Thursday, October 1, 2009
45days MIA
Aloha to all earthlings !
I am sorry to say that I will not have the time to update this blog during the 45days. This is simply because I have major exams coming up. So please come back in mid-nov.
x.o.x.o Ƹ̵̡Ӝ̵̨̄Ʒ x.o.x.o yours cammie
|
|
|
|
|
|
|
|
|
introduction
I'm tough, I'm ambitious,
and I know exactly what I want.
If that makes me a bitch, okay.
I am my own experiment and my own work of art.
[Madonna Ciccone, 1992]
| | | | |